How to make GNU Parallel takes input from multiple FASTA for multiple core processing

[Gundala Viswanath]

Hi,

I have a code that can be executed the following way:


    $ ./mycode [param1] [param2] [input1-fasta] [input2-fasta] [output-file]

To execute it for example:


     $ ./mycode 4 4 input.fasta input2.fasta output.txt

Typically the code would do all-against-all sequence comparison.

Fasta files look like this:

    >Seq_1
    TTTGTTTGCTTCATATTGTAATTAATTTTAAAGAAA
    >Seq_2
    CTGTGACAAATTGCCCTTAACCCTGTGACAAATTGC

Note that the number of sequences of both input may be different.

What I want to do is to run that code command with multiple core and
chunking the files automatically using [GNU Parallel][1].
Hoping that it would run faster.

So I tried this command:

    $ parallel --pipe --recstart '>' "./mycode 4 4 input.fasta
input2.fasta output.txt"

But it fail to execute and it give me this instead:

    parallel: Warning: Input is read from the terminal. Only experts
do this on purpose. Press CTRL-D to exit.

What's the right way to do it?

- P.D.

  [1]: http://www.gnu.org/software/parallel/