[Top][All Lists]
[Date Prev][Date Next][Thread Prev][Thread Next][Date Index][Thread Index]
[Wesnoth-cvs-commits] wesnoth data/scenarios/tutorial/tutorial1.cfg d...
|
From: |
Yann Dirson |
|
Subject: |
[Wesnoth-cvs-commits] wesnoth data/scenarios/tutorial/tutorial1.cfg d... |
|
Date: |
Sun, 05 Sep 2004 12:44:20 -0400 |
CVSROOT: /cvsroot/wesnoth
Module name: wesnoth
Branch:
Changes by: Yann Dirson <address@hidden> 04/09/05 16:39:11
Modified files:
data/scenarios/tutorial: tutorial1.cfg tutorial2.cfg utils.cfg
po : wesnoth.pot
po/fr : wesnoth-tdh.po
Log message:
Fixed gettextisation of tutorial strings in macro args
CVSWeb URLs:
http://savannah.gnu.org/cgi-bin/viewcvs/wesnoth/wesnoth/data/scenarios/tutorial/tutorial1.cfg.diff?tr1=1.3&tr2=1.4&r1=text&r2=text
http://savannah.gnu.org/cgi-bin/viewcvs/wesnoth/wesnoth/data/scenarios/tutorial/tutorial2.cfg.diff?tr1=1.2&tr2=1.3&r1=text&r2=text
http://savannah.gnu.org/cgi-bin/viewcvs/wesnoth/wesnoth/data/scenarios/tutorial/utils.cfg.diff?tr1=1.2&tr2=1.3&r1=text&r2=text
http://savannah.gnu.org/cgi-bin/viewcvs/wesnoth/wesnoth/po/wesnoth.pot.diff?tr1=1.18&tr2=1.19&r1=text&r2=text
http://savannah.gnu.org/cgi-bin/viewcvs/wesnoth/wesnoth/po/fr/wesnoth-tdh.po.diff?tr1=1.3&tr2=1.4&r1=text&r2=text
Patches:
Index: wesnoth/data/scenarios/tutorial/tutorial1.cfg
diff -u wesnoth/data/scenarios/tutorial/tutorial1.cfg:1.3
wesnoth/data/scenarios/tutorial/tutorial1.cfg:1.4
--- wesnoth/data/scenarios/tutorial/tutorial1.cfg:1.3 Fri Aug 27 15:34:51 2004
+++ wesnoth/data/scenarios/tutorial/tutorial1.cfg Sun Sep 5 16:39:10 2004
@@ -70,7 +70,7 @@
description=Delfador
message= _ "Before entering any battle, you need to recruit
units. To recruit a unit, right click on the castle tile on which you wish to
recruit the unit. Then select Recruit, and select 'Ok'. You can only recruit
units on castle tiles connected to the keep your leader is on."
[/message]
- {SET_OBJECTIVE (Recruit a unit)}
+ {SET_OBJECTIVE (_"Recruit a unit")}
[/event]
[event]
name=recruit
@@ -78,12 +78,12 @@
description=Delfador
message= _ "Excellent! You have recruited an Elvish Fighter."
[/message]
- {QUESTION_OPTIONS_START (What do I do next?)}
+ {QUESTION_OPTIONS_START (_"What do I do next?")}
#define RECRUIT_QUESTIONS
-{QUESTION_OPTION (How do I recruit units?) (To recruit a unit, right click on
the castle tile on which you wish to recruit the unit. Then select Recruit, or
just hold your cursor over the tile and press 'Ctrl-R'. Next, select the type
of unit that you want to recruit, and select 'Ok'. In order to recruit faster,
you can use 'Ctrl-Shift-R' to re-recruit the last type of unit you recruited.)}
-{QUESTION_OPTION (What's a leader?) (A leader is a unit that can recruit. This
means that when the leader is on a keep, he can recruit units on the
surrounding castle tiles. Leaders are usually powerful units that each side
only controls one of. Also, your leader is usually the first unit that your
side controls, and starts on a keep. You can select your leader quickly by
pressing 'l'. If your leader dies, you lose the game. You can win most
scenarios by defeating all enemy leaders.)}
-{QUESTION_OPTION (How should I choose what kind of units to recruit?) (You
have to carefully review their skills, which are displayed to the left of the
unit selection box, and cost, which is displayed after the name of the unit.
You will learn more about these statistics throughout the tutorial.)}
-{QUESTION_OPTION (What happens when I recruit a unit?) (When you recruit a
unit, it appears at full health on a castle tile of your choice. It also
receives two traits, which will be discussed later. It cannot move or attack
until you end your turn.)}
+{QUESTION_OPTION (_"How do I recruit units?") (_"To recruit a unit, right
click on the castle tile on which you wish to recruit the unit. Then select
Recruit, or just hold your cursor over the tile and press 'Ctrl-R'. Next,
select the type of unit that you want to recruit, and select 'Ok'. In order to
recruit faster, you can use 'Ctrl-Shift-R' to re-recruit the last type of unit
you recruited.")}
+{QUESTION_OPTION (_"What's a leader?") (_"A leader is a unit that can recruit.
This means that when the leader is on a keep, he can recruit units on the
surrounding castle tiles. Leaders are usually powerful units that each side
only controls one of. Also, your leader is usually the first unit that your
side controls, and starts on a keep. You can select your leader quickly by
pressing 'l'. If your leader dies, you lose the game. You can win most
scenarios by defeating all enemy leaders.")}
+{QUESTION_OPTION (_"How should I choose what kind of units to recruit?")
(_"You have to carefully review their skills, which are displayed to the left
of the unit selection box, and cost, which is displayed after the name of the
unit. You will learn more about these statistics throughout the tutorial.")}
+{QUESTION_OPTION (_"What happens when I recruit a unit?") (_"When you recruit
a unit, it appears at full health on a castle tile of your choice. It also
receives two traits, which will be discussed later. It cannot move or attack
until you end your turn.")}
#enddef
{RECRUIT_QUESTIONS}
{QUESTION_OPTIONS_END}
@@ -91,17 +91,17 @@
description=Delfador
message= _ "Since units cannot move on the turn they are
recruited, you must end your turn. To do this, simply click the 'End Turn'
button in the lower-right hand corner."
[/message]
- {SET_OBJECTIVE (End your turn)}
+ {SET_OBJECTIVE (_"End your turn")}
[event]
name=new turn
[message]
description=Delfador
message= _ "You have successfully ended your turn."
[/message]
- {QUESTION_OPTIONS_START (What do I do next?)}
+ {QUESTION_OPTIONS_START (_"What do I do next?")}
#define TURN_QUESTIONS
-{QUESTION_OPTION (How do I end my turn?) (One way to end your turn is to press
'Alt-E'. Alternatively, you can right-click and select End Turn, or select the
End Turn button in the lower-right hand corner.)}
-{QUESTION_OPTION (What happens when I end my turn?) (When you end your turn,
it becomes another side's turn and only that side has the right to move, until
that side ends its turn. After all sides end their turns, the next turn begins.
This has various effects, including causing all units to regain their full
movement potential. The number of the current turn is displayed on the status
bar next to the image of a flag. When this number exceeds the maximum number of
turns, you lose the game.)}
+{QUESTION_OPTION (_"How do I end my turn?") (_"One way to end your turn is to
press 'Alt-E'. Alternatively, you can right-click and select End Turn, or
select the End Turn button in the lower-right hand corner.")}
+{QUESTION_OPTION (_"What happens when I end my turn?") (_"When you end your
turn, it becomes another side's turn and only that side has the right to move,
until that side ends its turn. After all sides end their turns, the next turn
begins. This has various effects, including causing all units to regain their
full movement potential. The number of the current turn is displayed on the
status bar next to the image of a flag. When this number exceeds the maximum
number of turns, you lose the game.")}
#enddef
{TURN_QUESTIONS}
{QUESTION_OPTIONS_END}
@@ -109,7 +109,7 @@
description=Delfador
message= _ "Your next task is to move your Elvish Fighter. To
move a unit, first select it, then select his destination. In this case, his
destination is the forest next to the Elvish Shaman, Merle."
[/message]
- {SET_OBJECTIVE (Move your Elvish Fighter next to Merle)}
+ {SET_OBJECTIVE (_"Move your Elvish Fighter next to Merle")}
[move_unit_fake]
x=09,10,10,11,11
y=04,04,05,06,07
@@ -133,11 +133,11 @@
description=Delfador
message= _ "Excellent! You have successfully moved your Elvish
Fighter. However, since he moved next to an enemy unit, he has lost all his
movement for this turn; this is called the 'zone of control'."
[/message]
- {QUESTION_OPTIONS_START (What do I do next?)}
+ {QUESTION_OPTIONS_START (_"What do I do next?")}
#define MOVE_QUESTIONS
-{QUESTION_OPTION (How far can my Elvish Fighter move?) (Your Elvish Fighter
begins with a certain number of move points each turn; this is called his
speed. When your Elvish Fighter moves along a path, each hex he goes through
costs him move points; this includes his destination. When you select your
Elvish Fighter, all hexes he can't move onto within one turn will be shaded. If
the destination is far enough away that he needs more than one turn to reach
it, a number will appear showing how many turns it will take him. Clicking on a
far-away space will set the unit on a course for that space, which means it
automatically moves as far as it can towards that space every turn. If you
accidentally set a unit on a course, select it twice to remove the course.)}
-{QUESTION_OPTION (What's the zone of control?) (A unit's zone of control is
the location consisting of all hexes the unit is adjacent to. Units cannot move
through opponent's zones of control; they can only move into it. When they do
this, they lose all of their remaining movement. Zones of control can be used
to block enemies from reaching your weak and wounded units.)}
-{QUESTION_OPTION (How do I tell who is allied and who is an enemy?) (Units you
control have a green, yellow, or red energy circle above their health bar, the
green vertical bar next to them. Units with full movement have green: ones with
some movement yellow, ones with no movement red. Units controlled by the enemy
do not have an energy circle. Allied units you do not control, like me, have a
blue energy circle. Also, the option 'Show Team Colors', in Preferences, causes
the color of a unit's controller is displayed as a disc below the unit.)}
+{QUESTION_OPTION (_"How far can my Elvish Fighter move?") (_"Your Elvish
Fighter begins with a certain number of move points each turn; this is called
his speed. When your Elvish Fighter moves along a path, each hex he goes
through costs him move points; this includes his destination. When you select
your Elvish Fighter, all hexes he can't move onto within one turn will be
shaded. If the destination is far enough away that he needs more than one turn
to reach it, a number will appear showing how many turns it will take him.
Clicking on a far-away space will set the unit on a course for that space,
which means it automatically moves as far as it can towards that space every
turn. If you accidentally set a unit on a course, select it twice to remove the
course.")}
+{QUESTION_OPTION (_"What's the zone of control?") (_"A unit's zone of control
is the location consisting of all hexes the unit is adjacent to. Units cannot
move through opponent's zones of control; they can only move into it. When they
do this, they lose all of their remaining movement. Zones of control can be
used to block enemies from reaching your weak and wounded units.")}
+{QUESTION_OPTION (_"How do I tell who is allied and who is an enemy?")
(_"Units you control have a green, yellow, or red energy circle above their
health bar, the green vertical bar next to them. Units with full movement have
green: ones with some movement yellow, ones with no movement red. Units
controlled by the enemy do not have an energy circle. Allied units you do not
control, like me, have a blue energy circle. Also, the option 'Show Team
Colors', in Preferences, causes the color of a unit's controller is displayed
as a disc below the unit.")}
#enddef
{MOVE_QUESTIONS}
{QUESTION_OPTIONS_END}
@@ -145,7 +145,7 @@
description=Delfador
message= _ "Now, you need to attack with your fighter. To
attack, first select a unit, then select its target, which must be next to the
attacking unit. You will then see the attack options box, where you must select
an attack to use."
[/message]
- {SET_OBJECTIVE (Attack Merle)}
+ {SET_OBJECTIVE (_"Attack Merle")}
[event]
name=attack
[kill]
@@ -161,11 +161,11 @@
description=Delfador
message= _ "You have successfully attacked Merle."
[/message]
- {QUESTION_OPTIONS_START (What do I do next?)}
+ {QUESTION_OPTIONS_START (_"What do I do next?")}
#define ATTACK_QUESTIONS
-{QUESTION_OPTION (Can Merle retaliate from my attack?) (Whenever a unit is
attacked, it retaliates with one of their own weapons. This means that after
each blow from the attacker, the defender retaliates with one blow. This
continues until one side runs out of blows, in which case the other unit
continues attacking until its blows are depleted as well. However, any unit can
only retaliate by using a weapon of the same range as the one used to attack.
This means that a ranged attack can only be countered by a ranged attack and a
melee attack can only be countered by a melee attack. Most units have more
powerful melee attacks than ranged, so units with ranged attacks are useful in
that retaliation against them is less powerful; often there is no retaliation.
However ranged units cannot shoot across multiple hexes; this is one of the
distinctive features of Wesnoth.)}
-{QUESTION_OPTION (How can you tell how powerful a unit's attacks are?) (Every
attack does a certain amount of damage per hit, and can be used a certain
number of times per battle. These numbers, called the attack's damage and
strike numbers, are displayed in order under the name of the attack on the
unit's status table and next to it on the attack options menu. To quickly find
the maximum damage an attack can inflict, multiply the damage by the number of
strikes. For example, my lightning attack does 14 damage per blow and has 4
blows, so it can deal up to 56 damage in a single combat.)}
-{QUESTION_OPTION (Will my fighter hit every time when he attacks?) (Units have
the ability to block blows. The chance that a unit has to hit is based on the
defender's skill at defending blows, and is listed on the attack options menu
after the damage and strike numbers for the bow attack.)}
+{QUESTION_OPTION (_"Can Merle retaliate from my attack?") (_"Whenever a unit
is attacked, it retaliates with one of their own weapons. This means that after
each blow from the attacker, the defender retaliates with one blow. This
continues until one side runs out of blows, in which case the other unit
continues attacking until its blows are depleted as well. However, any unit can
only retaliate by using a weapon of the same range as the one used to attack.
This means that a ranged attack can only be countered by a ranged attack and a
melee attack can only be countered by a melee attack. Most units have more
powerful melee attacks than ranged, so units with ranged attacks are useful in
that retaliation against them is less powerful; often there is no retaliation.
However ranged units cannot shoot across multiple hexes; this is one of the
distinctive features of Wesnoth.")}
+{QUESTION_OPTION (_"How can you tell how powerful a unit's attacks are?")
(_"Every attack does a certain amount of damage per hit, and can be used a
certain number of times per battle. These numbers, called the attack's damage
and strike numbers, are displayed in order under the name of the attack on the
unit's status table and next to it on the attack options menu. To quickly find
the maximum damage an attack can inflict, multiply the damage by the number of
strikes. For example, my lightning attack does 14 damage per blow and has 4
blows, so it can deal up to 56 damage in a single combat.")}
+{QUESTION_OPTION (_"Will my fighter hit every time when he attacks?") (_"Units
have the ability to block blows. The chance that a unit has to hit is based on
the defender's skill at defending blows, and is listed on the attack options
menu after the damage and strike numbers for the bow attack.")}
#enddef
{ATTACK_QUESTIONS}
{QUESTION_OPTIONS_END}
@@ -179,10 +179,10 @@
description=Delfador
message= _ "Your fighter has survived Merle's attack. Whenever
a unit survives a battle, it gets experience from the combat. Once a unit gains
enough experience, it advances to the next level, and becomes more powerful."
[/message]
- {QUESTION_OPTIONS_START (What do I do next?)}
+ {QUESTION_OPTIONS_START (_"What do I do next?")}
#define XP_QUESTIONS
-{QUESTION_OPTION (What's experience?) (When a unit fights another unit, it
gains experience, denoted 'XP', from the combat. The amount of experience
gained is equal to the opponent's level, which is usually a representation of
that unit's power. However, much more experience is gained from defeating an
enemy unit. The amount of XP gained from killing an enemy is equal to 8 times
the enemy's level.)}
-{QUESTION_OPTION (What happens when a unit advances?) (When a unit advances,
it transforms into a different unit type. This unit type is dependent on what
the unit was originally, but occasionally there will be more than one choice of
what to advance into. Advanced units are usually more powerful and 1 level
higher than they were originally. Also, when a unit advances, it is healed
completely and any handicaps that have been cast on it are removed. This is
known as 'advance-heal'.)}
+{QUESTION_OPTION (_"What's experience?") (_"When a unit fights another unit,
it gains experience, denoted 'XP', from the combat. The amount of experience
gained is equal to the opponent's level, which is usually a representation of
that unit's power. However, much more experience is gained from defeating an
enemy unit. The amount of XP gained from killing an enemy is equal to 8 times
the enemy's level.")}
+{QUESTION_OPTION (_"What happens when a unit advances?") (_"When a unit
advances, it transforms into a different unit type. This unit type is dependent
on what the unit was originally, but occasionally there will be more than one
choice of what to advance into. Advanced units are usually more powerful and 1
level higher than they were originally. Also, when a unit advances, it is
healed completely and any handicaps that have been cast on it are removed. This
is known as 'advance-heal'.")}
#enddef
{XP_QUESTIONS}
{QUESTION_OPTIONS_END}
@@ -190,7 +190,7 @@
description=Delfador
message= _ "Move your fighter onto a village."
[/message]
- {SET_OBJECTIVE (Move your fighter onto a village)}
+ {SET_OBJECTIVE (_"Move your fighter onto a village")}
[event]
name=moveto
[filter]
@@ -203,10 +203,10 @@
description=Delfador
message= _ "Villages heal the units on them."
[/message]
- {QUESTION_OPTIONS_START (What do I do next?)}
+ {QUESTION_OPTIONS_START (_"What do I do next?")}
#define VILLAGE_QUESTIONS
-{QUESTION_OPTION (What happens when a unit moves onto a village?) (Whenever a
unit moves onto a village, he flags the village for his side. This action takes
all of the unit's remaining movement. Villages flagged for a side give the side
several benefits, including giving the side a extra gold coin every turn, and
reducing the total upkeep cost of that side's units by one. The total number of
villages you control is also displayed on the status bar after the picture of a
house. In addition to the economic benefit of villages, villages can be used in
battle. Villages heal the units on them 8 HP per turn.)}
-{QUESTION_OPTION (How do I heal when there aren't any villages nearby?) (There
are ways to heal even without villages. If a unit does not move or attack for 1
turn, he heals 2 HP from resting. However if an enemy attacks him he cannot
receive rest-heal. Also, there are some units which heal the units surrounding
them. The Elvish Shaman is one such unit; units next to an Elvish Shaman are
healed 4 HP per turn. Finally, whenever you win a level all your units are
healed fully.)}
+{QUESTION_OPTION (_"What happens when a unit moves onto a village?")
(_"Whenever a unit moves onto a village, he flags the village for his side.
This action takes all of the unit's remaining movement. Villages flagged for a
side give the side several benefits, including giving the side a extra gold
coin every turn, and reducing the total upkeep cost of that side's units by
one. The total number of villages you control is also displayed on the status
bar after the picture of a house. In addition to the economic benefit of
villages, villages can be used in battle. Villages heal the units on them 8 HP
per turn.")}
+{QUESTION_OPTION (_"How do I heal when there aren't any villages nearby?")
(_"There are ways to heal even without villages. If a unit does not move or
attack for 1 turn, he heals 2 HP from resting. However if an enemy attacks him
he cannot receive rest-heal. Also, there are some units which heal the units
surrounding them. The Elvish Shaman is one such unit; units next to an Elvish
Shaman are healed 4 HP per turn. Finally, whenever you win a level all your
units are healed fully.")}
#enddef
{VILLAGE_QUESTIONS}
{QUESTION_OPTIONS_END}
@@ -214,7 +214,7 @@
description=Delfador
message= _ "Now, you must defeat Merle by reducing her to 0 HP
or lower. Just attack repeatedly."
[/message]
- {SET_OBJECTIVE (Defeat Merle)}
+ {SET_OBJECTIVE (_"Defeat Merle")}
[/event]
[/event]
[/event]
@@ -229,7 +229,7 @@
[/filter]
[message]
description=Delfador
- message=Oops! You moved your leader off of the keep. Remember,
when your leader is not on a keep, you cannot recruit. Also remember that if
your leader dies, you lose. In order to continue the tutorial, I will have to
teleport you back onto your keep.
+ message=_"Oops! You moved your leader off of the keep.
Remember, when your leader is not on a keep, you cannot recruit. Also remember
that if your leader dies, you lose. In order to continue the tutorial, I will
have to teleport you back onto your keep."
[/message]
[teleport]
[filter]
@@ -264,10 +264,10 @@
description=Delfador
message= _ "You have successfully completed the first training
scenario."
[/message]
- {QUESTION_OPTIONS_START (Hooray!)}
+ {QUESTION_OPTIONS_START (_"Hooray!")}
#define VICTORY_QUESTIONS
-{QUESTION_OPTION (How do I know how to complete a scenario? Will you always
tell me?) (Sometimes it is not clear how to win a scenario just by listening to
the dialog. In this case you need to look at the scenario objectives, which
appear after the opening dialog. It can also be accessed by clicking
'Objectives' on the menu. The scenario objectives are a list of victory
conditions and defeat conditions, and if any of the conditions are met, the
level is over. Hopefully, it was a victory condition that was met.)}
-{QUESTION_OPTION (What happens when I win a scenario?) (When you win a
scenario, all of your units survive and are revived to full health, and you do
not have to pay them for the remaining turns. Also, if your army remains in the
area after you win, all villages surrender to you immediately after you win.
However between scenarios, 20% of your gold is lost.)}
+{QUESTION_OPTION (_"How do I know how to complete a scenario? Will you always
tell me?") (_"Sometimes it is not clear how to win a scenario just by listening
to the dialog. In this case you need to look at the scenario objectives, which
appear after the opening dialog. It can also be accessed by clicking
'Objectives' on the menu. The scenario objectives are a list of victory
conditions and defeat conditions, and if any of the conditions are met, the
level is over. Hopefully, it was a victory condition that was met.")}
+{QUESTION_OPTION (_"What happens when I win a scenario?") (_"When you win a
scenario, all of your units survive and are revived to full health, and you do
not have to pay them for the remaining turns. Also, if your army remains in the
area after you win, all villages surrender to you immediately after you win.
However between scenarios, 20% of your gold is lost.")}
#enddef
{VICTORY_QUESTIONS}
{QUESTION_OPTIONS_END}
@@ -277,7 +277,7 @@
[option]
message= _ "Yes"
[command]
- {QUESTION_OPTIONS_START (I'm done reviewing
skills!)}
+ {QUESTION_OPTIONS_START (_"I'm done reviewing
skills!")}
{RECRUIT_QUESTIONS}
{TURN_QUESTIONS}
{MOVE_QUESTIONS}
Index: wesnoth/data/scenarios/tutorial/tutorial2.cfg
diff -u wesnoth/data/scenarios/tutorial/tutorial2.cfg:1.2
wesnoth/data/scenarios/tutorial/tutorial2.cfg:1.3
--- wesnoth/data/scenarios/tutorial/tutorial2.cfg:1.2 Fri Aug 27 15:34:51 2004
+++ wesnoth/data/scenarios/tutorial/tutorial2.cfg Sun Sep 5 16:39:10 2004
@@ -1,6 +1,6 @@
{./utils.cfg}
[tutorial]
-name=Traits and Specialties
+name=_"Traits and Specialties"
id=tutorial-2
map_data="ggggggggggggggggccggggtff
gggtggggggggtggccggggggff
@@ -85,10 +85,10 @@
description=Delfador
message= _ "You have successfully recalled your Elvish Fighter."
[/message]
- {QUESTION_OPTIONS_START (En guarde!)}
+ {QUESTION_OPTIONS_START (_"En guarde!")}
#define RECALL_QUESTIONS
-{QUESTION_OPTION (What happens when I recall a unit?) (First, you must pay 20
pieces of gold for each unit you recall, regardless of the type of unit. Other
than that, recalled units are basically like recruited units, except that
instead of a new unit appearing, a unit from a previous scenario will appear.)}
-{QUESTION_OPTION (How should I decide which units to recall?) (You should
usually recall units that have already advanced to the next level. However, you
may also want to recall units that have high experience, and are thus likely to
advance. You should recall units that will be useful for the scenario you are
in; for example in a forest scenario, recall elves.)}
+{QUESTION_OPTION (_"What happens when I recall a unit?") (_"First, you must
pay 20 pieces of gold for each unit you recall, regardless of the type of unit.
Other than that, recalled units are basically like recruited units, except that
instead of a new unit appearing, a unit from a previous scenario will appear.")}
+{QUESTION_OPTION (_"How should I decide which units to recall?") (_"You should
usually recall units that have already advanced to the next level. However, you
may also want to recall units that have high experience, and are thus likely to
advance. You should recall units that will be useful for the scenario you are
in; for example in a forest scenario, recall elves.")}
#enddef
{RECALL_QUESTIONS}
{QUESTION_OPTIONS_END}
@@ -99,10 +99,10 @@
description=Delfador
message= _ "You may notice that your units have slightly
different statistics than the statistics shown before you recruited them. This
is because they have been assigned traits."
[/message]
- {QUESTION_OPTIONS_START (En guarde!)}
+ {QUESTION_OPTIONS_START (_"En guarde!")}
#define TRAIT_QUESTIONS
-{QUESTION_OPTION (What do traits do?) (The function of traits is add variety
by making units of the same type different from each other. This is done by
randomly assigning each unit traits when they are recruited. The traits that a
unit has are displayed on the Status Table, and the function of a specific
trait can be found by putting your cursor over that trait.)}
-{QUESTION_OPTION (What kind of traits can my units get?) (There are five
distinct traits, which have effects ranging from increasing a unit's hit points
to decreasing the amount of XP required to advance. However all traits are
designed to improve unit's power; there are no 'negative' traits. Most units
have an equal chance to get any two different traits when they are recruited.)}
+{QUESTION_OPTION (_"What do traits do?") (_"The function of traits is add
variety by making units of the same type different from each other. This is
done by randomly assigning each unit traits when they are recruited. The traits
that a unit has are displayed on the Status Table, and the function of a
specific trait can be found by putting your cursor over that trait.")}
+{QUESTION_OPTION (_"What kind of traits can my units get?") (_"There are five
distinct traits, which have effects ranging from increasing a unit's hit points
to decreasing the amount of XP required to advance. However all traits are
designed to improve unit's power; there are no 'negative' traits. Most units
have an equal chance to get any two different traits when they are recruited.")}
#enddef
{TRAIT_QUESTIONS}
{QUESTION_OPTIONS_END}
@@ -114,10 +114,10 @@
description=Delfador
message= _ "When you recruit and recall units, you lose gold.
If this would cause you to have less than 0 gold, you cannot recruit or recall."
[/message]
- {QUESTION_OPTIONS_START (En guarde!)}
+ {QUESTION_OPTIONS_START (_"En guarde!")}
#define GOLD_QUESTIONS
-{QUESTION_OPTION (How much gold do my units cost?) (You need to pay each unit
you recruit or recall gold when you recruit it. The cost of recruiting a unit
is displayed under the unit's name. The cost of recalling a unit is always 20
gold. A unit also costs gold for each turn it is under your control. This cost,
called 'upkeep', is equal to the level of the unit. However, units you do not
recruit or recall such as your leader do not cost any gold at all. The total
upkeep cost of your units is displayed on the status bar at the top after a
picture of gold and then a red arrow.)}
-{QUESTION_OPTION (How do I get gold?) (You begin each level with a percentage
of gold from the previous level. If this is less than 100 gold, you begin with
100 gold instead. The amount of gold you have is displayed on the status bar
after the picture of gold. After the start of a scenario, you receive 2 gold
every turn. Since you usually need more gold than that, you should flag
villages, which give you 1 gold per turn.)}
+{QUESTION_OPTION (_"How much gold do my units cost?") (_"You need to pay each
unit you recruit or recall gold when you recruit it. The cost of recruiting a
unit is displayed under the unit's name. The cost of recalling a unit is always
20 gold. A unit also costs gold for each turn it is under your control. This
cost, called 'upkeep', is equal to the level of the unit. However, units you do
not recruit or recall such as your leader do not cost any gold at all. The
total upkeep cost of your units is displayed on the status bar at the top after
a picture of gold and then a red arrow.")}
+{QUESTION_OPTION (_"How do I get gold?") (_"You begin each level with a
percentage of gold from the previous level. If this is less than 100 gold, you
begin with 100 gold instead. The amount of gold you have is displayed on the
status bar after the picture of gold. After the start of a scenario, you
receive 2 gold every turn. Since you usually need more gold than that, you
should flag villages, which give you 1 gold per turn.")}
#enddef
{GOLD_QUESTIONS}
{QUESTION_OPTIONS_END}
@@ -128,10 +128,10 @@
description=Delfador
message= _ "The sun is setting over Wesnoth. The time of day
affects how much damage units of different alignments can inflict upon each
other."
[/message]
- {QUESTION_OPTIONS_START (En guarde!)}
+ {QUESTION_OPTIONS_START (_"En guarde!")}
#define TIME_QUESTIONS
-{QUESTION_OPTION (What are the different alignments and times of day?) (There
are 3 alignments: Lawful, Neutral, and Chaotic. There are also 3 times of day:
day, twilight, and night. During day, units of the alignment Lawful, such as
humans, do 25% more damage, while Chaotic units such as undead do 25% less. At
night it is reversed. During twilight, all units do their normal damage.
Neutral units such as elves are unaffected by day and night.)}
-{QUESTION_OPTION (How do I know what time of day it is?) (The times of day
usually progress in a sequence: dawn- identical to twilight, morning- day,
evening- day, dusk- twilight, first-watch- night, second-watch- night, then
repeat. This is represented by the sun and moon which each rise in the east and
set in the west. However some scenarios have a different sequence, such as
underground where it is perpetually night. You can find out the current time of
day by looking at the Status Table.)}
+{QUESTION_OPTION (_"What are the different alignments and times of day?")
(_"There are 3 alignments: Lawful, Neutral, and Chaotic. There are also 3 times
of day: day, twilight, and night. During day, units of the alignment Lawful,
such as humans, do 25% more damage, while Chaotic units such as undead do 25%
less. At night it is reversed. During twilight, all units do their normal
damage. Neutral units such as elves are unaffected by day and night.")}
+{QUESTION_OPTION (_"How do I know what time of day it is?") (_"The times of
day usually progress in a sequence: dawn- identical to twilight, morning- day,
evening- day, dusk- twilight, first-watch- night, second-watch- night, then
repeat. This is represented by the sun and moon which each rise in the east and
set in the west. However some scenarios have a different sequence, such as
underground where it is perpetually night. You can find out the current time of
day by looking at the Status Table.")}
#enddef
{TIME_QUESTIONS}
{QUESTION_OPTIONS_END}
@@ -142,10 +142,10 @@
description=Delfador
message= _ "Each hex has a terrain, which gives the hex
distinctive properties."
[/message]
- {QUESTION_OPTIONS_START (En guarde!)}
+ {QUESTION_OPTIONS_START (_"En guarde!")}
#define TERRAIN_QUESTIONS
-{QUESTION_OPTION (What are the different properties that terrains have?) (Two
terrains have properties which have already been described; namely villages and
castle. However the properties of most terrains are more subtle, and have to do
with the advantages and disadvantages different units have when they move onto
them. The first property of a terrain is the number of move points it takes
each unit to move through the hex. The second property is the defense that the
terrain gives units standing on it. This is a percentage which determines the
unit's chance to be hit on that terrain. For example; elves have 70% defense on
grass, and are therefore hit 30% of the time.)}
-{QUESTION_OPTION (How do I find out the properties of a specific terrain?) (To
find out the properties of a terrain with respect to a specific unit,
right-click on the unit, select Unit Description, then select Terrain
Modifiers. To find out which terrain is on a particular hex, move your cursor
over that hex and look in the upper-right hand corner of the screen. This will
display, in order, the name of the terrain, then the coordinates of the hex,
then the selected unit's defense, then the number of move points it will cost
the selected unit to move through that hex.)}
+{QUESTION_OPTION (_"What are the different properties that terrains have?")
(_"Two terrains have properties which have already been described; namely
villages and castle. However the properties of most terrains are more subtle,
and have to do with the advantages and disadvantages different units have when
they move onto them. The first property of a terrain is the number of move
points it takes each unit to move through the hex. The second property is the
defense that the terrain gives units standing on it. This is a percentage which
determines the unit's chance to be hit on that terrain. For example; elves have
70% defense on grass, and are therefore hit 30% of the time.")}
+{QUESTION_OPTION (_"How do I find out the properties of a specific terrain?")
(_"To find out the properties of a terrain with respect to a specific unit,
right-click on the unit, select Unit Description, then select Terrain
Modifiers. To find out which terrain is on a particular hex, move your cursor
over that hex and look in the upper-right hand corner of the screen. This will
display, in order, the name of the terrain, then the coordinates of the hex,
then the selected unit's defense, then the number of move points it will cost
the selected unit to move through that hex.")}
#enddef
{TERRAIN_QUESTIONS}
{QUESTION_OPTIONS_END}
@@ -156,10 +156,10 @@
description=Delfador
message= _ "Each attack has a damage type which affects how
much damage different units take from that attack."
[/message]
- {QUESTION_OPTIONS_START (En guarde!)}
+ {QUESTION_OPTIONS_START (_"En guarde!")}
#define RESISTANCE_QUESTIONS
-{QUESTION_OPTION (How does resistance affect attack damage?) (Each unit has a
certain resistance against each attack type. This resistance is a percentage
which is subtracted from the damage of opponent's weapons of that type. For
example, if an Elvish Scout is attacked by an Elvish Archer, the archer does
20% more damage than normal, since Elvish Scouts have -20% resistance to
pierce. This bonus/penalty is calculated additively with other
bonuses/penalties like time of day, so two -50% penalties would add up to
-100%.)}
-{QUESTION_OPTION (What are the different damage types?) (There are 6 different
damage types: blade, pierce, impact, fire, cold, and holy. Heavily armored
units have high resistance to the physical types: blade, pierce, and impact,
but low resistance to the magical types: fire and cold. All living units have
resistance to holy while undead are extremely weak to it. To find out a
specific unit's resistance, right-click on the unit, select Unit Description,
then select Resistance.)}
+{QUESTION_OPTION (_"How does resistance affect attack damage?") (_"Each unit
has a certain resistance against each attack type. This resistance is a
percentage which is subtracted from the damage of opponent's weapons of that
type. For example, if an Elvish Scout is attacked by an Elvish Archer, the
archer does 20% more damage than normal, since Elvish Scouts have -20%
resistance to pierce. This bonus/penalty is calculated additively with other
bonuses/penalties like time of day, so two -50% penalties would add up to
-100%.")}
+{QUESTION_OPTION (_"What are the different damage types?") (_"There are 6
different damage types: blade, pierce, impact, fire, cold, and holy. Heavily
armored units have high resistance to the physical types: blade, pierce, and
impact, but low resistance to the magical types: fire and cold. All living
units have resistance to holy while undead are extremely weak to it. To find
out a specific unit's resistance, right-click on the unit, select Unit
Description, then select Resistance.")}
#enddef
{RESISTANCE_QUESTIONS}
{QUESTION_OPTIONS_END}
@@ -170,12 +170,12 @@
description=Delfador
message= _ "Many units have a specialty which changes the rules
of play in some way."
[/message]
- {QUESTION_OPTIONS_START (En guarde!)}
+ {QUESTION_OPTIONS_START (_"En guarde!")}
#define SPECIALTIES_QUESTIONS
-{QUESTION_OPTION (What do specialties do?) (Each specialty does something
different; that's the whole point of a specialty. To find a description of a
unit's specialty, put your cursor over the name of the specialty.)}
-{QUESTION_OPTION (Which units get specialties?) (The specialties a unit gets
are determined by the unit type; for example all generals have the specialty
leadership. There are two kinds of specialties: abilities, and attack specials.
Abilities apply to units while attack specials only apply to one of the unit's
attacks.)}
-{QUESTION_OPTION (What kinds of specialties can my units get?) (There are many
different specialties, and learning about them is one of the interesting parts
of playing Wesnoth. The two most common specialties are called 'magical' and
'leadership'. Magical attacks have a 70% chance of hitting enemies regardless
of what terrain they are on. Units do more damage while next to a unit of
higher level with leadership.)}
-{QUESTION_OPTION (How do I use specialties?) (To use a specialty, you just
have to move and/or attack with your units in a way which triggers the
specialty. For example, in order to use leadership, you must move a unit with
leadership next to another unit, then attack with the other unit.)}
+{QUESTION_OPTION (_"What do specialties do?") (_"Each specialty does something
different; that's the whole point of a specialty. To find a description of a
unit's specialty, put your cursor over the name of the specialty.")}
+{QUESTION_OPTION (_"Which units get specialties?") (_"The specialties a unit
gets are determined by the unit type; for example all generals have the
specialty leadership. There are two kinds of specialties: abilities, and attack
specials. Abilities apply to units while attack specials only apply to one of
the unit's attacks.")}
+{QUESTION_OPTION (_"What kinds of specialties can my units get?") (_"There are
many different specialties, and learning about them is one of the interesting
parts of playing Wesnoth. The two most common specialties are called 'magical'
and 'leadership'. Magical attacks have a 70% chance of hitting enemies
regardless of what terrain they are on. Units do more damage while next to a
unit of higher level with leadership.")}
+{QUESTION_OPTION (_"How do I use specialties?") (_"To use a specialty, you
just have to move and/or attack with your units in a way which triggers the
specialty. For example, in order to use leadership, you must move a unit with
leadership next to another unit, then attack with the other unit.")}
#enddef
{SPECIALTIES_QUESTIONS}
{QUESTION_OPTIONS_END}
@@ -199,14 +199,14 @@
apply_to=attack
increase_damage=4
[/effect]
- description=This potion increases the damage of all the
drinker's attacks by four.
+ description=_"This potion increases the damage of all the
drinker's attacks by four."
name=Strength Potion
image=items/potion-red.png
[/object]
- {QUESTION_OPTIONS_START (En guarde!)}
+ {QUESTION_OPTIONS_START (_"En guarde!")}
#define OBJECT_QUESTIONS
-{QUESTION_OPTION (What kind of objects am I likely to encounter?) (The objects
you encounter are put in by the scenario designer, so they vary from campaign
to campaign. In Heir to the Throne, most objects give the unit who picks them
up a new weapon. However there are usually not that many objects in a
campaign.)}
-{QUESTION_OPTION (How long do these objects last?) (Most objects are permanent
changes to the unit that receives them. However a few objects, such as holy
water, last only until the remainder of the level.)}
+{QUESTION_OPTION (_"What kind of objects am I likely to encounter?") (_"The
objects you encounter are put in by the scenario designer, so they vary from
campaign to campaign. In Heir to the Throne, most objects give the unit who
picks them up a new weapon. However there are usually not that many objects in
a campaign.")}
+{QUESTION_OPTION (_"How long do these objects last?") (_"Most objects are
permanent changes to the unit that receives them. However a few objects, such
as holy water, last only until the remainder of the level.")}
#enddef
{OBJECT_QUESTIONS}
{QUESTION_OPTIONS_END}
@@ -249,10 +249,10 @@
description=Delfador
message= _ "Congratulations! You have defeated me, and
completed the second and final training scenario. Next, you may want to begin a
campaign, or play multiplayer."
[/message]
- {QUESTION_OPTIONS_START (Hooray!)}
+ {QUESTION_OPTIONS_START (_"Hooray!")}
#define WESNOTH_QUESTIONS
-{QUESTION_OPTION (How do I play a campaign?) (To begin a campaign, run
Wesnoth, select 'Campaign', select which campaign to play, then select Easy,
Normal, or Hard. Heir to the Throne is the suggested for newcomers to Wesnoth.)}
-{QUESTION_OPTION (How do I play multiplayer?) (To play Wesnoth against other
people, select 'Multiplayer'. If you have the latest development version of
Wesnoth, select 'Join Official Server'. However, if you have version 1.0,
select 'Join Game', then type in 'server.wesnoth.org'. This will connect you to
the official Wesnoth server, where you can join a game by selecting it, then
selecting 'Join Game'.)}
+{QUESTION_OPTION (_"How do I play a campaign?") (_"To begin a campaign, run
Wesnoth, select 'Campaign', select which campaign to play, then select Easy,
Normal, or Hard. Heir to the Throne is the suggested for newcomers to
Wesnoth.")}
+{QUESTION_OPTION (_"How do I play multiplayer?") (_"To play Wesnoth against
other people, select 'Multiplayer'. If you have the latest development version
of Wesnoth, select 'Join Official Server'. However, if you have version 1.0,
select 'Join Game', then type in 'server.wesnoth.org'. This will connect you to
the official Wesnoth server, where you can join a game by selecting it, then
selecting 'Join Game'.")}
#enddef
{WESNOTH_QUESTIONS}
{QUESTION_OPTIONS_END}
@@ -262,7 +262,7 @@
[option]
message= _ "Yes"
[command]
- {QUESTION_OPTIONS_START (I'm done reviewing
skills!)}
+ {QUESTION_OPTIONS_START (_"I'm done reviewing
skills!")}
{RECALL_QUESTIONS}
{TRAIT_QUESTIONS}
{GOLD_QUESTIONS}
Index: wesnoth/data/scenarios/tutorial/utils.cfg
diff -u wesnoth/data/scenarios/tutorial/utils.cfg:1.2
wesnoth/data/scenarios/tutorial/utils.cfg:1.3
--- wesnoth/data/scenarios/tutorial/utils.cfg:1.2 Fri Aug 27 15:34:51 2004
+++ wesnoth/data/scenarios/tutorial/utils.cfg Sun Sep 5 16:39:10 2004
@@ -10,7 +10,7 @@
description=Konrad
message= _ "That was explained well! But.."
[option]
- message= _ "{END_MESSAGE}"
+ message={END_MESSAGE}
[command]
{CLEAR_VARIABLE still_asking_questions}
[/command]
@@ -18,11 +18,11 @@
#enddef
#define QUESTION_OPTION QUESTION ANSWER
[option]
-message= _ "{QUESTION}"
+message={QUESTION}
[command]
[message]
description=Delfador
- message= _ "{ANSWER}"
+ message={ANSWER}
[/message]
[/command]
[/option]
Index: wesnoth/po/fr/wesnoth-tdh.po
diff -u wesnoth/po/fr/wesnoth-tdh.po:1.3 wesnoth/po/fr/wesnoth-tdh.po:1.4
--- wesnoth/po/fr/wesnoth-tdh.po:1.3 Sat Sep 4 17:16:43 2004
+++ wesnoth/po/fr/wesnoth-tdh.po Sun Sep 5 16:39:11 2004
@@ -1,22 +1,25 @@
+# translation of wesnoth-tdh.po to French
# Language french translations for Battle for Wesnoth package
# vim:set encoding=utf-8:
# Traduction anglaise du package Battle for Wesnoth.
# Copyright (C) 2004 THE Battle for Wesnoth'S COPYRIGHT HOLDER
# This file is distributed under the same license as the Battle for Wesnoth
package.
# French Wesnoth translation team <address@hidden>, 2004.
+# Yann Dirson <address@hidden>, 2004.
#
msgid ""
msgstr ""
-"Project-Id-Version: Battle for Wesnoth 0.7.11-CVS\n"
+"Project-Id-Version: wesnoth-tdh\n"
"Report-Msgid-Bugs-To: http://bugs.wesnoth.org/\n";
"POT-Creation-Date: 2004-08-08 15:00+0200\n"
-"PO-Revision-Date: 2004-09-04 19:05+0200\n"
-"Last-Translator: Guillaume Melquiond <address@hidden>\n"
-"Language-Team: Language fr\n"
+"PO-Revision-Date: 2004-09-05 15:20+0200\n"
+"Last-Translator: Yann Dirson <address@hidden>\n"
+"Language-Team: French <address@hidden>\n"
"MIME-Version: 1.0\n"
"Content-Type: text/plain; charset=UTF-8\n"
"Content-Transfer-Encoding: 8bit\n"
-"Plural-Forms: nplurals=2; plural=(n > 1);\n"
+"X-Generator: KBabel 1.3.1\n"
+"Plural-Forms: nplurals=2; plural=(n > 1);\n"
#: data/scenarios/The_Dark_Hordes/A_New_Chance.cfg:3
msgid "A New Chance"
@@ -84,8 +87,8 @@
"As the sun set, Gwiti discovered that his arch-rival and brother, Nati, had "
"already ensconced himself nearby."
msgstr ""
-"Alors que le soleil se couchait, Gwiti découvrit que Nati, son rival et "
-"frère, s'était déjà bien installé non loin de là ."
+"Alors que le soleil se couchait, Gwiti découvrit que son rival et frère, "
+"Nati, s'était déjà bien installé non loin de là ."
#: data/scenarios/The_Dark_Hordes/Brother_Against_Brother.cfg:73
msgid ""
@@ -666,7 +669,7 @@
#: data/scenarios/The_Dark_Hordes/The_Skull_of_Agarash.cfg:10
msgid "Still fleeing from Wesnoth, Gwiti entered the lands of the Orcs."
-msgstr ""
+msgstr "Fuyant toujours Wesnoth, Gwiti pénétra sur les territoires des Orcs."
#: data/scenarios/The_Dark_Hordes/The_Skull_of_Agarash.cfg:52
msgid ""
@@ -747,7 +750,7 @@
#: data/scenarios/The_Dark_Hordes/The_Skull_of_Agarash.cfg:205
msgid "Let us trample his banner into the ground! *smash*"
-msgstr ""
+msgstr "Piétinons cette bannière ! *smash*"
#: data/scenarios/The_Dark_Hordes/The_Skull_of_Agarash.cfg:220
msgid "That skull is powerless!"
@@ -822,15 +825,18 @@
"Nay, Lord. These passages were flooded higher last time I was here. The "
"Dwarves did not delve here, and we shunned the nameless dread we felt."
msgstr ""
+"Non, Seigneur. Ces passages étaient plus inondés la dernière fois que je "
+"suis venu ici. Les nains ne fouillaient pas par ici, et nous avons fuit la "
+"terreur innommable que nous ressentions."
#: data/scenarios/The_Dark_Hordes/Underground_Pool.cfg:210
msgid "If there is anything to dread here, it is me. Now, onward!"
msgstr ""
-"S'il y a quelque-chose à redouter ici, c'est moi. Maintenant en avant !"
+"S'il y a quelque-chose à craindre ici, c'est moi. Maintenant en avant !"
#: data/scenarios/The_Dark_Hordes/Underground_Pool.cfg:234
msgid "The Hoard of the Dwarves! Three hundred gold at least!"
-msgstr "Le trésor des nains ! Trois cents or au moins !"
+msgstr "Le trésor des nains ! Trois cents pièces d'or au moins !"
#: data/scenarios/The_Dark_Hordes/Underground_Pool.cfg:252
msgid "You swore you would protect me!"
@@ -846,7 +852,7 @@
"à la grande bataille du Rocher de Erzen, les frères Gwiti et Nati Ha'atel "
"ont montré pour la première fois leurs talents : pensant que leur camp
était "
"en train de perdre la bataille, ils invoquèrent les cadavres de leurs "
-"anciens ennemis, pour se lever à nouveau et à combattre à leur coté."
+"anciens ennemis, pour se lever à nouveau et à combattre à leurs cotés."
#: data/scenarios/The_Dark_Hordes/intro.cfg:15
msgid ""
@@ -857,8 +863,8 @@
msgstr ""
"Pourtant, non seulement était-ce interdit, mais aussi imprudent. La "
"cavalerie devant arriver en renfort se heurta aux légions de morts-vivants. "
-"Ainsi la bataille fut perdue alors qu'elle aurait été gagnée n'y eût-il
pas "
-"eu ces deux nécromanciens."
+"Ainsi la bataille fut perdue alors qu'elle aurait été gagnée sans "
+"l'intervention de ces deux nécromanciens."
#: data/scenarios/The_Dark_Hordes/intro.cfg:25
msgid ""
@@ -866,10 +872,9 @@
"in irons, marched onto a ship with no rudder, and sent off to drown in the "
"sea, for the Wesnothians feared that their corpses might only rise again."
msgstr ""
-"Les frères Ha'atel s'enfuirent. Immédiatement, à leur retour, ils furent
mis "
-"au fers, embarqué dans un bateau sans gouvernail et envoyés se noyer dans
la "
-"mer. Pour les Wesnothiens, leur seule crainte était de voir à nouveau leurs
"
-"corps se relever."
+"Les frères Ha'atel s'enfuirent. Dès à leur retour, ils furent mis au fers,
"
+"embarqués dans un bateau sans gouvernail et envoyés se noyer dans la mer, "
+"les Wesnothiens craignant de voir leurs cadavres se lever à nouveau."
#: data/scenarios/The_Dark_Hordes/intro.cfg:35
msgid ""
@@ -878,5 +883,5 @@
"of the Rise of the Dark Hordes."
msgstr ""
"Mais le destin intervint. Le bateau fut assailli par un orage soudain puis "
-"désintégré, séparant les frères et les jetant tous les deux à terre.
C'était "
-"le commencement du soulèvement des hordes sombres."
+"désintégré, séparant les frères et les jetant tous les deux à la côte.
"
+"C'était le commencement du soulèvement des Hordes Sombres."
Index: wesnoth/po/wesnoth.pot
diff -u wesnoth/po/wesnoth.pot:1.18 wesnoth/po/wesnoth.pot:1.19
--- wesnoth/po/wesnoth.pot:1.18 Sat Sep 4 10:42:46 2004
+++ wesnoth/po/wesnoth.pot Sun Sep 5 16:39:10 2004
@@ -10,7 +10,7 @@
"#-#-#-#-# wesnoth.cpp.po (PACKAGE VERSION) #-#-#-#-#\n"
"Project-Id-Version: PACKAGE VERSION\n"
"Report-Msgid-Bugs-To: http://bugs.wesnoth.org/\n";
-"POT-Creation-Date: 2004-09-04 11:52+0200\n"
+"POT-Creation-Date: 2004-09-05 18:26+0200\n"
"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
"Last-Translator: FULL NAME <address@hidden>\n"
"Language-Team: LANGUAGE <address@hidden>\n"
@@ -21,7 +21,7 @@
"Project-Id-Version: PACKAGE VERSION\n"
"Report-Msgid-Bugs-To: http://bugs.wesnoth.org/\n";
"POT-Creation-Date: 2004-08-08 15:00+0200\n"
-"PO-Revision-Date: YEAR-MO-DA HO:MI+ZONE\n"
+"PO-Revision-Date: 2004-09-05 18:10+0200\n"
"Last-Translator: FULL NAME <address@hidden>\n"
"Language-Team: LANGUAGE <address@hidden>\n"
"MIME-Version: 1.0\n"
@@ -842,10 +842,73 @@
"connected to the keep your leader is on."
msgstr ""
+#: data/scenarios/tutorial/tutorial1.cfg:73
+msgid "Recruit a unit"
+msgstr ""
+
#: data/scenarios/tutorial/tutorial1.cfg:79
msgid "Excellent! You have recruited an Elvish Fighter."
msgstr ""
+#: data/scenarios/tutorial/tutorial1.cfg:81
+#: data/scenarios/tutorial/tutorial1.cfg:101
+#: data/scenarios/tutorial/tutorial1.cfg:136
+#: data/scenarios/tutorial/tutorial1.cfg:164
+#: data/scenarios/tutorial/tutorial1.cfg:182
+#: data/scenarios/tutorial/tutorial1.cfg:206
+msgid "What do I do next?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:83
+msgid "How do I recruit units?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:83
+msgid ""
+"To recruit a unit, right click on the castle tile on which you wish to "
+"recruit the unit. Then select Recruit, or just hold your cursor over the "
+"tile and press 'Ctrl-R'. Next, select the type of unit that you want to "
+"recruit, and select 'Ok'. In order to recruit faster, you can use 'Ctrl-"
+"Shift-R' to re-recruit the last type of unit you recruited."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:84
+msgid ""
+"A leader is a unit that can recruit. This means that when the leader is on a "
+"keep, he can recruit units on the surrounding castle tiles. Leaders are "
+"usually powerful units that each side only controls one of. Also, your "
+"leader is usually the first unit that your side controls, and starts on a "
+"keep. You can select your leader quickly by pressing 'l'. If your leader "
+"dies, you lose the game. You can win most scenarios by defeating all enemy "
+"leaders."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:84
+msgid "What's a leader?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:85
+msgid "How should I choose what kind of units to recruit?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:85
+msgid ""
+"You have to carefully review their skills, which are displayed to the left "
+"of the unit selection box, and cost, which is displayed after the name of "
+"the unit. You will learn more about these statistics throughout the tutorial."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:86
+msgid "What happens when I recruit a unit?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:86
+msgid ""
+"When you recruit a unit, it appears at full health on a castle tile of your "
+"choice. It also receives two traits, which will be discussed later. It "
+"cannot move or attack until you end your turn."
+msgstr ""
+
#: data/scenarios/tutorial/tutorial1.cfg:92
msgid ""
"Since units cannot move on the turn they are recruited, you must end your "
@@ -853,10 +916,39 @@
"corner."
msgstr ""
+#: data/scenarios/tutorial/tutorial1.cfg:94
+msgid "End your turn"
+msgstr ""
+
#: data/scenarios/tutorial/tutorial1.cfg:99
msgid "You have successfully ended your turn."
msgstr ""
+#: data/scenarios/tutorial/tutorial1.cfg:103
+msgid "How do I end my turn?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:103
+msgid ""
+"One way to end your turn is to press 'Alt-E'. Alternatively, you can right-"
+"click and select End Turn, or select the End Turn button in the lower-right "
+"hand corner."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:104
+msgid "What happens when I end my turn?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:104
+msgid ""
+"When you end your turn, it becomes another side's turn and only that side "
+"has the right to move, until that side ends its turn. After all sides end "
+"their turns, the next turn begins. This has various effects, including "
+"causing all units to regain their full movement potential. The number of the "
+"current turn is displayed on the status bar next to the image of a flag. "
+"When this number exceeds the maximum number of turns, you lose the game."
+msgstr ""
+
#: data/scenarios/tutorial/tutorial1.cfg:110
msgid ""
"Your next task is to move your Elvish Fighter. To move a unit, first select "
@@ -864,6 +956,10 @@
"next to the Elvish Shaman, Merle."
msgstr ""
+#: data/scenarios/tutorial/tutorial1.cfg:112
+msgid "Move your Elvish Fighter next to Merle"
+msgstr ""
+
#: data/scenarios/tutorial/tutorial1.cfg:134
msgid ""
"Excellent! You have successfully moved your Elvish Fighter. However, since "
@@ -871,6 +967,52 @@
"this is called the 'zone of control'."
msgstr ""
+#: data/scenarios/tutorial/tutorial1.cfg:138
+msgid "How far can my Elvish Fighter move?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:138
+msgid ""
+"Your Elvish Fighter begins with a certain number of move points each turn; "
+"this is called his speed. When your Elvish Fighter moves along a path, each "
+"hex he goes through costs him move points; this includes his destination. "
+"When you select your Elvish Fighter, all hexes he can't move onto within one "
+"turn will be shaded. If the destination is far enough away that he needs "
+"more than one turn to reach it, a number will appear showing how many turns "
+"it will take him. Clicking on a far-away space will set the unit on a course "
+"for that space, which means it automatically moves as far as it can towards "
+"that space every turn. If you accidentally set a unit on a course, select it "
+"twice to remove the course."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:139
+msgid ""
+"A unit's zone of control is the location consisting of all hexes the unit is "
+"adjacent to. Units cannot move through opponent's zones of control; they can "
+"only move into it. When they do this, they lose all of their remaining "
+"movement. Zones of control can be used to block enemies from reaching your "
+"weak and wounded units."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:139
+msgid "What's the zone of control?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:140
+msgid "How do I tell who is allied and who is an enemy?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:140
+msgid ""
+"Units you control have a green, yellow, or red energy circle above their "
+"health bar, the green vertical bar next to them. Units with full movement "
+"have green: ones with some movement yellow, ones with no movement red. Units "
+"controlled by the enemy do not have an energy circle. Allied units you do "
+"not control, like me, have a blue energy circle. Also, the option 'Show Team "
+"Colors', in Preferences, causes the color of a unit's controller is "
+"displayed as a disc below the unit."
+msgstr ""
+
#: data/scenarios/tutorial/tutorial1.cfg:146
msgid ""
"Now, you need to attack with your fighter. To attack, first select a unit, "
@@ -878,10 +1020,61 @@
"then see the attack options box, where you must select an attack to use."
msgstr ""
+#: data/scenarios/tutorial/tutorial1.cfg:148
+msgid "Attack Merle"
+msgstr ""
+
#: data/scenarios/tutorial/tutorial1.cfg:162
msgid "You have successfully attacked Merle."
msgstr ""
+#: data/scenarios/tutorial/tutorial1.cfg:166
+msgid "Can Merle retaliate from my attack?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:166
+msgid ""
+"Whenever a unit is attacked, it retaliates with one of their own weapons. "
+"This means that after each blow from the attacker, the defender retaliates "
+"with one blow. This continues until one side runs out of blows, in which "
+"case the other unit continues attacking until its blows are depleted as "
+"well. However, any unit can only retaliate by using a weapon of the same "
+"range as the one used to attack. This means that a ranged attack can only be "
+"countered by a ranged attack and a melee attack can only be countered by a "
+"melee attack. Most units have more powerful melee attacks than ranged, so "
+"units with ranged attacks are useful in that retaliation against them is "
+"less powerful; often there is no retaliation. However ranged units cannot "
+"shoot across multiple hexes; this is one of the distinctive features of "
+"Wesnoth."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:167
+msgid ""
+"Every attack does a certain amount of damage per hit, and can be used a "
+"certain number of times per battle. These numbers, called the attack's "
+"damage and strike numbers, are displayed in order under the name of the "
+"attack on the unit's status table and next to it on the attack options menu. "
+"To quickly find the maximum damage an attack can inflict, multiply the "
+"damage by the number of strikes. For example, my lightning attack does 14 "
+"damage per blow and has 4 blows, so it can deal up to 56 damage in a single "
+"combat."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:167
+msgid "How can you tell how powerful a unit's attacks are?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:168
+msgid ""
+"Units have the ability to block blows. The chance that a unit has to hit is "
+"based on the defender's skill at defending blows, and is listed on the "
+"attack options menu after the damage and strike numbers for the bow attack."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:168
+msgid "Will my fighter hit every time when he attacks?"
+msgstr ""
+
#: data/scenarios/tutorial/tutorial1.cfg:174
msgid "End your turn, and wait for Merle to attack you."
msgstr ""
@@ -893,20 +1086,93 @@
"advances to the next level, and becomes more powerful."
msgstr ""
+#: data/scenarios/tutorial/tutorial1.cfg:184
+msgid "What's experience?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:184
+msgid ""
+"When a unit fights another unit, it gains experience, denoted 'XP', from the "
+"combat. The amount of experience gained is equal to the opponent's level, "
+"which is usually a representation of that unit's power. However, much more "
+"experience is gained from defeating an enemy unit. The amount of XP gained "
+"from killing an enemy is equal to 8 times the enemy's level."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:185
+msgid "What happens when a unit advances?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:185
+msgid ""
+"When a unit advances, it transforms into a different unit type. This unit "
+"type is dependent on what the unit was originally, but occasionally there "
+"will be more than one choice of what to advance into. Advanced units are "
+"usually more powerful and 1 level higher than they were originally. Also, "
+"when a unit advances, it is healed completely and any handicaps that have "
+"been cast on it are removed. This is known as 'advance-heal'."
+msgstr ""
+
#: data/scenarios/tutorial/tutorial1.cfg:191
msgid "Move your fighter onto a village."
msgstr ""
+#: data/scenarios/tutorial/tutorial1.cfg:193
+msgid "Move your fighter onto a village"
+msgstr ""
+
#: data/scenarios/tutorial/tutorial1.cfg:204
msgid "Villages heal the units on them."
msgstr ""
+#: data/scenarios/tutorial/tutorial1.cfg:208
+msgid "What happens when a unit moves onto a village?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:208
+msgid ""
+"Whenever a unit moves onto a village, he flags the village for his side. "
+"This action takes all of the unit's remaining movement. Villages flagged for "
+"a side give the side several benefits, including giving the side a extra "
+"gold coin every turn, and reducing the total upkeep cost of that side's "
+"units by one. The total number of villages you control is also displayed on "
+"the status bar after the picture of a house. In addition to the economic "
+"benefit of villages, villages can be used in battle. Villages heal the units "
+"on them 8 HP per turn."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:209
+msgid "How do I heal when there aren't any villages nearby?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:209
+msgid ""
+"There are ways to heal even without villages. If a unit does not move or "
+"attack for 1 turn, he heals 2 HP from resting. However if an enemy attacks "
+"him he cannot receive rest-heal. Also, there are some units which heal the "
+"units surrounding them. The Elvish Shaman is one such unit; units next to an "
+"Elvish Shaman are healed 4 HP per turn. Finally, whenever you win a level "
+"all your units are healed fully."
+msgstr ""
+
#: data/scenarios/tutorial/tutorial1.cfg:215
msgid ""
"Now, you must defeat Merle by reducing her to 0 HP or lower. Just attack "
"repeatedly."
msgstr ""
+#: data/scenarios/tutorial/tutorial1.cfg:217
+msgid "Defeat Merle"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:232
+msgid ""
+"Oops! You moved your leader off of the keep. Remember, when your leader is "
+"not on a keep, you cannot recruit. Also remember that if your leader dies, "
+"you lose. In order to continue the tutorial, I will have to teleport you "
+"back onto your keep."
+msgstr ""
+
#: data/scenarios/tutorial/tutorial1.cfg:248
#: data/scenarios/tutorial/tutorial2.cfg:233
msgid ""
@@ -925,6 +1191,38 @@
msgid "You have successfully completed the first training scenario."
msgstr ""
+#: data/scenarios/tutorial/tutorial1.cfg:267
+#: data/scenarios/tutorial/tutorial2.cfg:252
+msgid "Hooray!"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:269
+msgid "How do I know how to complete a scenario? Will you always tell me?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:269
+msgid ""
+"Sometimes it is not clear how to win a scenario just by listening to the "
+"dialog. In this case you need to look at the scenario objectives, which "
+"appear after the opening dialog. It can also be accessed by clicking "
+"'Objectives' on the menu. The scenario objectives are a list of victory "
+"conditions and defeat conditions, and if any of the conditions are met, the "
+"level is over. Hopefully, it was a victory condition that was met."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:270
+msgid "What happens when I win a scenario?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial1.cfg:270
+msgid ""
+"When you win a scenario, all of your units survive and are revived to full "
+"health, and you do not have to pay them for the remaining turns. Also, if "
+"your army remains in the area after you win, all villages surrender to you "
+"immediately after you win. However between scenarios, 20% of your gold is "
+"lost."
+msgstr ""
+
#: data/scenarios/tutorial/tutorial1.cfg:276
#: data/scenarios/tutorial/tutorial2.cfg:261
msgid "Do you want to review any of the skills learned on this level?"
@@ -935,6 +1233,11 @@
msgid "Yes"
msgstr ""
+#: data/scenarios/tutorial/tutorial1.cfg:280
+#: data/scenarios/tutorial/tutorial2.cfg:265
+msgid "I'm done reviewing skills!"
+msgstr ""
+
#: data/scenarios/tutorial/tutorial1.cfg:297
msgid ""
"Although you have completed your first scenario, your training is not yet "
@@ -942,6 +1245,10 @@
"in a mock battle."
msgstr ""
+#: data/scenarios/tutorial/tutorial2.cfg:3
+msgid "Traits and Specialties"
+msgstr ""
+
#: data/scenarios/tutorial/tutorial2.cfg:60
msgid ""
"Now you will be subject to a more difficult test. You must defeat me in mock "
@@ -978,6 +1285,41 @@
msgid "You have successfully recalled your Elvish Fighter."
msgstr ""
+#: data/scenarios/tutorial/tutorial2.cfg:88
+#: data/scenarios/tutorial/tutorial2.cfg:102
+#: data/scenarios/tutorial/tutorial2.cfg:117
+#: data/scenarios/tutorial/tutorial2.cfg:131
+#: data/scenarios/tutorial/tutorial2.cfg:145
+#: data/scenarios/tutorial/tutorial2.cfg:159
+#: data/scenarios/tutorial/tutorial2.cfg:173
+#: data/scenarios/tutorial/tutorial2.cfg:206
+msgid "En guarde!"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:90
+msgid ""
+"First, you must pay 20 pieces of gold for each unit you recall, regardless "
+"of the type of unit. Other than that, recalled units are basically like "
+"recruited units, except that instead of a new unit appearing, a unit from a "
+"previous scenario will appear."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:90
+msgid "What happens when I recall a unit?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:91
+msgid "How should I decide which units to recall?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:91
+msgid ""
+"You should usually recall units that have already advanced to the next "
+"level. However, you may also want to recall units that have high experience, "
+"and are thus likely to advance. You should recall units that will be useful "
+"for the scenario you are in; for example in a forest scenario, recall elves."
+msgstr ""
+
#: data/scenarios/tutorial/tutorial2.cfg:100
msgid ""
"You may notice that your units have slightly different statistics than the "
@@ -985,33 +1327,225 @@
"assigned traits."
msgstr ""
+#: data/scenarios/tutorial/tutorial2.cfg:104
+msgid ""
+"The function of traits is add variety by making units of the same type "
+"different from each other. This is done by randomly assigning each unit "
+"traits when they are recruited. The traits that a unit has are displayed on "
+"the Status Table, and the function of a specific trait can be found by "
+"putting your cursor over that trait."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:104
+msgid "What do traits do?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:105
+msgid ""
+"There are five distinct traits, which have effects ranging from increasing a "
+"unit's hit points to decreasing the amount of XP required to advance. "
+"However all traits are designed to improve unit's power; there are no "
+"'negative' traits. Most units have an equal chance to get any two different "
+"traits when they are recruited."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:105
+msgid "What kind of traits can my units get?"
+msgstr ""
+
#: data/scenarios/tutorial/tutorial2.cfg:115
msgid ""
"When you recruit and recall units, you lose gold. If this would cause you to "
"have less than 0 gold, you cannot recruit or recall."
msgstr ""
+#: data/scenarios/tutorial/tutorial2.cfg:119
+msgid "How much gold do my units cost?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:119
+msgid ""
+"You need to pay each unit you recruit or recall gold when you recruit it. "
+"The cost of recruiting a unit is displayed under the unit's name. The cost "
+"of recalling a unit is always 20 gold. A unit also costs gold for each turn "
+"it is under your control. This cost, called 'upkeep', is equal to the level "
+"of the unit. However, units you do not recruit or recall such as your leader "
+"do not cost any gold at all. The total upkeep cost of your units is "
+"displayed on the status bar at the top after a picture of gold and then a "
+"red arrow."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:120
+msgid "How do I get gold?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:120
+msgid ""
+"You begin each level with a percentage of gold from the previous level. If "
+"this is less than 100 gold, you begin with 100 gold instead. The amount of "
+"gold you have is displayed on the status bar after the picture of gold. "
+"After the start of a scenario, you receive 2 gold every turn. Since you "
+"usually need more gold than that, you should flag villages, which give you 1 "
+"gold per turn."
+msgstr ""
+
#: data/scenarios/tutorial/tutorial2.cfg:129
msgid ""
"The sun is setting over Wesnoth. The time of day affects how much damage "
"units of different alignments can inflict upon each other."
msgstr ""
+#: data/scenarios/tutorial/tutorial2.cfg:133
+msgid ""
+"There are 3 alignments: Lawful, Neutral, and Chaotic. There are also 3 times "
+"of day: day, twilight, and night. During day, units of the alignment Lawful, "
+"such as humans, do 25% more damage, while Chaotic units such as undead do "
+"25% less. At night it is reversed. During twilight, all units do their "
+"normal damage. Neutral units such as elves are unaffected by day and night."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:133
+msgid "What are the different alignments and times of day?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:134
+msgid "How do I know what time of day it is?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:134
+msgid ""
+"The times of day usually progress in a sequence: dawn- identical to "
+"twilight, morning- day, evening- day, dusk- twilight, first-watch- night, "
+"second-watch- night, then repeat. This is represented by the sun and moon "
+"which each rise in the east and set in the west. However some scenarios have "
+"a different sequence, such as underground where it is perpetually night. You "
+"can find out the current time of day by looking at the Status Table."
+msgstr ""
+
#: data/scenarios/tutorial/tutorial2.cfg:143
msgid "Each hex has a terrain, which gives the hex distinctive properties."
msgstr ""
+#: data/scenarios/tutorial/tutorial2.cfg:147
+msgid ""
+"Two terrains have properties which have already been described; namely "
+"villages and castle. However the properties of most terrains are more "
+"subtle, and have to do with the advantages and disadvantages different units "
+"have when they move onto them. The first property of a terrain is the number "
+"of move points it takes each unit to move through the hex. The second "
+"property is the defense that the terrain gives units standing on it. This is "
+"a percentage which determines the unit's chance to be hit on that terrain. "
+"For example; elves have 70% defense on grass, and are therefore hit 30% of "
+"the time."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:147
+msgid "What are the different properties that terrains have?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:148
+msgid "How do I find out the properties of a specific terrain?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:148
+msgid ""
+"To find out the properties of a terrain with respect to a specific unit, "
+"right-click on the unit, select Unit Description, then select Terrain "
+"Modifiers. To find out which terrain is on a particular hex, move your "
+"cursor over that hex and look in the upper-right hand corner of the screen. "
+"This will display, in order, the name of the terrain, then the coordinates "
+"of the hex, then the selected unit's defense, then the number of move points "
+"it will cost the selected unit to move through that hex."
+msgstr ""
+
#: data/scenarios/tutorial/tutorial2.cfg:157
msgid ""
"Each attack has a damage type which affects how much damage different units "
"take from that attack."
msgstr ""
+#: data/scenarios/tutorial/tutorial2.cfg:161
+msgid ""
+"Each unit has a certain resistance against each attack type. This resistance "
+"is a percentage which is subtracted from the damage of opponent's weapons of "
+"that type. For example, if an Elvish Scout is attacked by an Elvish Archer, "
+"the archer does 20% more damage than normal, since Elvish Scouts have -20% "
+"resistance to pierce. This bonus/penalty is calculated additively with other "
+"bonuses/penalties like time of day, so two -50% penalties would add up to -"
+"100%."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:161
+msgid "How does resistance affect attack damage?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:162
+msgid ""
+"There are 6 different damage types: blade, pierce, impact, fire, cold, and "
+"holy. Heavily armored units have high resistance to the physical types: "
+"blade, pierce, and impact, but low resistance to the magical types: fire and "
+"cold. All living units have resistance to holy while undead are extremely "
+"weak to it. To find out a specific unit's resistance, right-click on the "
+"unit, select Unit Description, then select Resistance."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:162
+msgid "What are the different damage types?"
+msgstr ""
+
#: data/scenarios/tutorial/tutorial2.cfg:171
msgid ""
"Many units have a specialty which changes the rules of play in some way."
msgstr ""
+#: data/scenarios/tutorial/tutorial2.cfg:175
+msgid ""
+"Each specialty does something different; that's the whole point of a "
+"specialty. To find a description of a unit's specialty, put your cursor over "
+"the name of the specialty."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:175
+msgid "What do specialties do?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:176
+msgid ""
+"The specialties a unit gets are determined by the unit type; for example all "
+"generals have the specialty leadership. There are two kinds of specialties: "
+"abilities, and attack specials. Abilities apply to units while attack "
+"specials only apply to one of the unit's attacks."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:176
+msgid "Which units get specialties?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:177
+msgid ""
+"There are many different specialties, and learning about them is one of the "
+"interesting parts of playing Wesnoth. The two most common specialties are "
+"called 'magical' and 'leadership'. Magical attacks have a 70% chance of "
+"hitting enemies regardless of what terrain they are on. Units do more damage "
+"while next to a unit of higher level with leadership."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:177
+msgid "What kinds of specialties can my units get?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:178
+msgid "How do I use specialties?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:178
+msgid ""
+"To use a specialty, you just have to move and/or attack with your units in a "
+"way which triggers the specialty. For example, in order to use leadership, "
+"you must move a unit with leadership next to another unit, then attack with "
+"the other unit."
+msgstr ""
+
#: data/scenarios/tutorial/tutorial2.cfg:195
msgid ""
"Some objects change the statistics of the unit that triggered them. One of "
@@ -1019,6 +1553,32 @@
"To see his new combat statistics, look at the Status Table."
msgstr ""
+#: data/scenarios/tutorial/tutorial2.cfg:202
+msgid "This potion increases the damage of all the drinker's attacks by four."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:208
+msgid ""
+"The objects you encounter are put in by the scenario designer, so they vary "
+"from campaign to campaign. In Heir to the Throne, most objects give the unit "
+"who picks them up a new weapon. However there are usually not that many "
+"objects in a campaign."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:208
+msgid "What kind of objects am I likely to encounter?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:209
+msgid "How long do these objects last?"
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:209
+msgid ""
+"Most objects are permanent changes to the unit that receives them. However a "
+"few objects, such as holy water, last only until the remainder of the level."
+msgstr ""
+
#: data/scenarios/tutorial/tutorial2.cfg:223
msgid ""
"Remember to try to prevent the enemy from capturing villages, and to "
@@ -1033,20 +1593,32 @@
"multiplayer."
msgstr ""
-#: data/scenarios/tutorial/utils.cfg:11
-msgid "That was explained well! But.."
+#: data/scenarios/tutorial/tutorial2.cfg:254
+msgid "How do I play a campaign?"
msgstr ""
-#: data/scenarios/tutorial/utils.cfg:13
-msgid "{END_MESSAGE}"
+#: data/scenarios/tutorial/tutorial2.cfg:254
+msgid ""
+"To begin a campaign, run Wesnoth, select 'Campaign', select which campaign "
+"to play, then select Easy, Normal, or Hard. Heir to the Throne is the "
+"suggested for newcomers to Wesnoth."
+msgstr ""
+
+#: data/scenarios/tutorial/tutorial2.cfg:255
+msgid "How do I play multiplayer?"
msgstr ""
-#: data/scenarios/tutorial/utils.cfg:21
-msgid "{QUESTION}"
+#: data/scenarios/tutorial/tutorial2.cfg:255
+msgid ""
+"To play Wesnoth against other people, select 'Multiplayer'. If you have the "
+"latest development version of Wesnoth, select 'Join Official Server'. "
+"However, if you have version 1.0, select 'Join Game', then type in 'server."
+"wesnoth.org'. This will connect you to the official Wesnoth server, where "
+"you can join a game by selecting it, then selecting 'Join Game'."
msgstr ""
-#: data/scenarios/tutorial/utils.cfg:25
-msgid "{ANSWER}"
+#: data/scenarios/tutorial/utils.cfg:11
+msgid "That was explained well! But.."
msgstr ""
#: data/scenarios/tutorial/utils.cfg:44
@@ -1949,8 +2521,8 @@
#: data/units/Assassin.cfg:16 data/units/Duelist.cfg:16
#: data/units/Fencer.cfg:16 data/units/Outlaw_Princess.cfg:17
-#: data/units/Rogue.cfg:16 data/units/Saurian.cfg:16
-#: data/units/Saurian_Warrior.cfg:16
+#: data/units/Rogue.cfg:16 data/units/Saurian.cfg:17
+#: data/units/Saurian_Warrior.cfg:17
msgid "skirmisher"
msgstr ""
@@ -2223,10 +2795,10 @@
#: data/units/Orcish_Shaman.cfg:69 data/units/Orcish_Shaman.cfg:112
#: data/units/Orcish_Sovereign.cfg:43 data/units/Orcish_Warlord.cfg:30
#: data/units/Paladin.cfg:42 data/units/Peasant.cfg:21
-#: data/units/Peasant.cfg:35 data/units/Pikeman.cfg:20
+#: data/units/Peasant.cfg:34 data/units/Pikeman.cfg:20
#: data/units/Pirate_Galleon.cfg:62 data/units/Poacher.cfg:42
-#: data/units/Saurian.cfg:20 data/units/Saurian.cfg:37
-#: data/units/Saurian_Warrior.cfg:20 data/units/Saurian_Warrior.cfg:37
+#: data/units/Saurian.cfg:21 data/units/Saurian.cfg:38
+#: data/units/Saurian_Warrior.cfg:21 data/units/Saurian_Warrior.cfg:38
#: data/units/Sea_Hag.cfg:21 data/units/Sea_Serpent.cfg:20
#: data/units/Sergeant.cfg:39 data/units/Skeleton_Archer.cfg:41
#: data/units/Soul_Shooter.cfg:38 data/units/Spearman.cfg:20
@@ -2309,9 +2881,9 @@
#: data/units/Drake_Guard.cfg:22 data/units/Drake_Slasher.cfg:52
#: data/units/Dwarvish_Guardsman.cfg:38 data/units/Dwarvish_Guardsman.cfg:52
#: data/units/Dwarvish_Stalwart.cfg:38 data/units/Dwarvish_Stalwart.cfg:52
-#: data/units/Horseman.cfg:20 data/units/Saurian.cfg:18
-#: data/units/Saurian.cfg:35 data/units/Saurian_Warrior.cfg:18
-#: data/units/Saurian_Warrior.cfg:35 data/units/Spearman.cfg:19
+#: data/units/Horseman.cfg:20 data/units/Saurian.cfg:19
+#: data/units/Saurian.cfg:36 data/units/Saurian_Warrior.cfg:19
+#: data/units/Saurian_Warrior.cfg:36 data/units/Spearman.cfg:19
#: data/units/Spearman.cfg:32
msgid "spear"
msgstr ""
@@ -3816,8 +4388,8 @@
"of superior forces."
msgstr ""
-#: data/units/Peasant.cfg:20 data/units/Peasant.cfg:34
-msgid "Pitch Fork"
+#: data/units/Peasant.cfg:20 data/units/Peasant.cfg:33
+msgid "pitchfork"
msgstr ""
#: data/units/Pikeman.cfg:3
| [Prev in Thread] |
Current Thread |
[Next in Thread] |
- [Wesnoth-cvs-commits] wesnoth data/scenarios/tutorial/tutorial1.cfg d...,
Yann Dirson <=